• Matlab TutorialsNo Comments

    default thumbnail

    When you are working with text, enclose sequences of characters in double quotes. You can assign text to a variable.

    t = "Hello, world";

    If the text includes double quotes, use two double quotes within the definition.

    q = "Something ""quoted"" and something ."
    q = 
    
        "Something "quoted" and something else."
    

    t and q are arrays, like all MATLAB® variables. Their class or data type is string.

     t
      Name        Size            Bytes  Class     Attributes
      t           1x1               174  string  
    
    

    To add text to the of a string, use the plus operator, +.

    f = 71;
    c = (f-32)/1.8;
    tempText = "Temperature is " + c + "C"
    
    tempText = 
    "Temperature is 21.6667C"
    

    Similar to numeric arrays, string arrays can have multiple elements. Use the strlength  to find the length of each string within an .

    A = ["a","bb","ccc"; "dddd","eeeeee","fffffff"]
    A = 
      2×3 string array
        "a"       "bb"        "ccc"    
        "dddd"    "eeeeee"    "fffffff"
    
    strlength(A)
    ans =
    
         1     2     3
         4     6     7

    Data in Character Arrays

    Sometimes characters represent data that does not correspond to text, such as a DNA sequence. You can store this type of data in a character array, which has data type char. Character arrays use quotes.

    seq = 'GCTAGAATCC';
    whos seq
    
      Name      Size            Bytes  Class    Attributes
      seq       1x10               20  char          

    Each element of the array contains a single character.

    seq(4)
    ans = 
        'A'
    

    Concatenate character arrays with square brackets, just as you concatenate numeric arrays.

    seq2 = [seq 'ATTAGAAACC']
    seq2 =
        'GCTAGAATCCATTAGAAACC'
    

    Character arrays are common in programs that were written before the introduction of string arrays. All that accept string data also accept char data, and vice versa.

    You might also be interested in :  Matlab Annotation Objects and Example

    Be the first to post a comment.

    Add a comment